3 years ago

Correction to: Gene mutation spectrum and genotype-phenotype correlation in a cohort of Chinese osteogenesis imperfecta patients revealed by targeted next generation sequencing

H. Yang, Y. Liu, W. Yu, M. Li, F. Lv, X. Xing, Asan, W. Xia, J. Wang, L. Song, X. Xu, Y. Zhu, O. Wang, Y. Jiang, D. Ma, J. Sun

Abstract

In Table 2:

Family 6 should be c.643-13_662delCTATCTTTTCTAGGGTCCCATGGGTCCCCGAGG instead of c.643-13_662delCTATCTTTTCTAGGGTCCCATGGGTCCCC.

Family 33 should be c.271_279dupGCCCTCTCG instead of c.271_279dupGCCCTCT.

In the 2nd para. of the Molecular diagnosis, section t(5;8)(q32;q21) should be t(5;7)(q32;q21).

Publisher URL: https://link.springer.com/article/10.1007/s00198-017-4250-6

DOI: 10.1007/s00198-017-4250-6

You might also like
Discover & Discuss Important Research

Keeping up-to-date with research can feel impossible, with papers being published faster than you'll ever be able to read them. That's where Researcher comes in: we're simplifying discovery and making important discussions happen. With over 19,000 sources, including peer-reviewed journals, preprints, blogs, universities, podcasts and Live events across 10 research areas, you'll never miss what's important to you. It's like social media, but better. Oh, and we should mention - it's free.

  • Download from Google Play
  • Download from App Store
  • Download from AppInChina

Researcher displays publicly available abstracts and doesn’t host any full article content. If the content is open access, we will direct clicks from the abstracts to the publisher website and display the PDF copy on our platform. Clicks to view the full text will be directed to the publisher website, where only users with subscriptions or access through their institution are able to view the full article.